ModCRE DB

Transcription factor

Q9NQZ8 - ZNF71

Endothelial zinc finger protein induced by tumor necrosis factor alpha (Zinc finger protein 71)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 489 aa

2 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known2
MotifPredictionSourceDNA bindingSupportLogoActions
M08267_2.00 Known CisBP CAGTTTCATTTTCC Direct PWM Open · Scan
M08383_2.00 Known CisBP TTTCCCTCTTCGCCTTGGCCGCCA Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 489 aa
139-292

Region 139-292 0 PWM

Residues
154 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
2I13
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 139-2921 model
Actions
Predicted = Low TFS_Q9NQZ8:139:292_2i13_A_1 2i13 139-292 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
130-152PF00096Zinc finger, C2H2 typeoverlaps 139-292
158-180PF00096Zinc finger, C2H2 typeoverlaps 139-292
186-208PF00096Zinc finger, C2H2 typeoverlaps 139-292
214-236PF00096Zinc finger, C2H2 typeoverlaps 139-292
242-264PF00096Zinc finger, C2H2 typeoverlaps 139-292
270-292PF00096Zinc finger, C2H2 typeoverlaps 139-292
298-320PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
326-348PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
354-376PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
382-404PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
410-432PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
438-460PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
466-488PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions