Transcription factor

Q9NR83 - SLC2A4RG

SLC2A4 regulator (GLUT4 enhancer factor) (GEF) (Huntington disease gene regulatory region-binding protein 1) (HDBP-1)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 387 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE6

Motif	Prediction	Source	DNA binding	Support	Actions
DIMER_sp_Q9NR83_S2A4R_HUMAN:77:119_5zko_H_1	ModCRE	Homology model	TTTGCCAAACGTTGGCCAAA	Region 77-119 · 1 3D model	Open · Scan
TFS_sp_Q9NR83_S2A4R_HUMAN:200:223_1ubd_C_1	ModCRE	Homology model	CCGGGCTAAACC	Region 200-223 · 1 3D model	Open · Scan
TFS_sp_Q9NR83_S2A4R_HUMAN:205:227_6e93_A_1	ModCRE	Homology model	AAAATAGCCCCC	Region 205-227 · 1 3D model	Open · Scan
TFS_sp_Q9NR83_S2A4R_HUMAN:205:227_6e94_A_1	ModCRE	Homology model	CTTAATTACCCC	Region 205-227 · 1 3D model	Open · Scan
TFS_sp_Q9NR83_S2A4R_HUMAN:207:222_8cuc_F_1	ModCRE	Homology model	GGGGTATTTG	Region 207-222 · 1 3D model	Open · Scan
TFS_sp_Q9NR83_S2A4R_HUMAN:355:387_7dta_A_1	ModCRE	Homology model	CCGACGCGGCC	Region 355-387 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 387 aa

77-119

200-227

355-387

Scan this region Show models

Scan this region Show models

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 5 summary rows

Region 77-1191 model

				Actions
Predicted = Low	DIMER_sp_Q9NR83_S2A4R_HUMAN:77:119_5zko_H_1	5zko	77-119	View model · PDB

Region 200-2274 models · 4 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
5	8cuc	355:387	207	222	P:F · DNA:A,B	62.5% / 75.0%	29	View · PDB TFS_sp_Q9NR83_S2A4R_HUMAN:207:222_8cuc_F_1
2	6e94	355:387	205	227	P:A · DNA:C,D	47.8% / 65.2%	19	View · PDB TFS_sp_Q9NR83_S2A4R_HUMAN:205:227_6e94_A_1
3	6e93	355:387	205	227	P:A · DNA:C,D	43.5% / 65.2%	19	View · PDB TFS_sp_Q9NR83_S2A4R_HUMAN:205:227_6e93_A_1
4	1ubd	355:387	200	223	P:C · DNA:A,B	37.5% / 62.5%	21	View · PDB TFS_sp_Q9NR83_S2A4R_HUMAN:200:223_1ubd_C_1

Region 355-3871 model · 1 summary row

				Actions
Predicted = Low	TFS_sp_Q9NR83_S2A4R_HUMAN:355:387_7dta_A_1	7dta	355-387	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
1	7dta	355:387	355	387	P:A · DNA:B,C	100.0% / 100.0%	100	View · PDB TFS_sp_Q9NR83_S2A4R_HUMAN:355:387_7dta_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
354-387	PF27556	Zinc finger protein 704 C-terminal domain	overlaps 355-387