ModCRE DB

Transcription factor

Q9NT61 - DKFZp564M2178

Zinc finger protein 574

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 644 aa

1 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M08239_2.00 Known CisBP GGGCCGCTCTAGGCTGCCGG Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 644 aa
213-592

Region 213-592 0 PWM

Residues
380 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs
Templates
1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
Region 213-5926 models
Actions
Predicted = Low DIMER_Q9NT61:512:563_1llm_C_1 1llm 512-563 View model · PDB
Predicted = Low TFS_Q9NT61:213:402_7w1m_H_1 7w1m 213-402 View model · PDB
Predicted = Low TFS_Q9NT61:223:374_2i13_A_1 2i13 223-374 View model · PDB
Predicted = Low TFS_Q9NT61:296:592_5wjq_D_1 5wjq 296-592 View model · PDB
Predicted = Low TFS_Q9NT61:298:592_5v3j_E_1 5v3j 298-592 View model · PDB
Predicted = Low TFS_Q9NT61:298:592_5v3m_C_1 5v3m 298-592 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
57-80PF12874Zinc-finger of C2H2 typeNo overlap with loaded model regions
84-106PF13894C2H2-type zinc fingerNo overlap with loaded model regions
243-265PF00096Zinc finger, C2H2 typeoverlaps 213-592
271-293PF00096Zinc finger, C2H2 typeoverlaps 213-592
299-321PF00096Zinc finger, C2H2 typeoverlaps 213-592
327-349PF13912C2H2-type zinc fingeroverlaps 213-592
487-508PF13912C2H2-type zinc fingeroverlaps 213-592
514-536PF00096Zinc finger, C2H2 typeoverlaps 213-592
570-592PF00096Zinc finger, C2H2 typeoverlaps 213-592