ModCRE DB

Transcription factor

Q9P0T4 - ZNF581

Zinc finger protein 581

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 197 aa

4 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M08339_2.00 NN 70-40% CisBP CTCGAACCCGGGACC 61.8% identity Open · Scan
M04642_2.00 NN 70-40% CisBP CATTATGTTAAATTATTACCCTA 52.0% identity Open · Scan
ModCRE2
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q9P0T4_ZN581_HUMAN:87:167_1a1f_A_1 ModCRE Homology model GGTCGTGTGG Region 87-167 · 1 3D model Open · Scan
TFS_sp_Q9P0T4_ZN581_HUMAN:87:167_1a1g_A_1 ModCRE Homology model TGCGTGTACC Region 87-167 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 197 aa
84-197

Region 84-197 2 PWM

Residues
114 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13894 · C2H2-type zinc finger
3D models
8 active PDBs · 6 summary rows
Templates
1A1F, 1A1G, 1LLM, 2I13, 5EGB, 5EH2, 5EI9, 7YSF
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 6 summary rows
Region 84-1978 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q9P0T4_ZN581_HUMAN:85:136_1llm_C_1 1llm 85-136 View model · PDB
Predicted = Low TFS_sp_Q9P0T4_ZN581_HUMAN:84:193_5egb_A_1 5egb 84-193 View model · PDB
Predicted = Low TFS_sp_Q9P0T4_ZN581_HUMAN:84:193_5ei9_E_1 5ei9 84-193 View model · PDB
Predicted = Low TFS_sp_Q9P0T4_ZN581_HUMAN:85:193_2i13_A_1 2i13 85-193 View model · PDB
Predicted = Low TFS_sp_Q9P0T4_ZN581_HUMAN:87:167_1a1f_A_1 1a1f 87-167 View model · PDB
Predicted = Low TFS_sp_Q9P0T4_ZN581_HUMAN:87:167_1a1g_A_1 1a1g 87-167 View model · PDB
Predicted = Low TFS_sp_Q9P0T4_ZN581_HUMAN:87:193_5eh2_F_1 5eh2 87-193 View model · PDB
Predicted = Low TFS_sp_Q9P0T4_ZN581_HUMAN:89:197_7ysf_A_1 7ysf 89-197 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 7ysf 84:197 89 197 P:A · DNA:B,C 66.1% / 78.0% 94 View · PDB TFS_sp_Q9P0T4_ZN581_HUMAN:89:197_7ysf_A_1
1 1llm 84:197 85,85 136,136 P:C,D · DNA:A,B 42.3% / 53.8% 59,61 View · PDB DIMER_sp_Q9P0T4_ZN581_HUMAN:85:136_1llm_C_1
4 5eh2 84:197 87 193 P:F · DNA:C,D 42.1% / 54.2% 96 View · PDB TFS_sp_Q9P0T4_ZN581_HUMAN:87:193_5eh2_F_1
2 5ei9 84:197 84 193 P:E · DNA:A,B 41.8% / 54.5% 97 View · PDB TFS_sp_Q9P0T4_ZN581_HUMAN:84:193_5ei9_E_1
3 5egb 84:197 84 193 P:A · DNA:C,D 41.8% / 54.5% 97 View · PDB TFS_sp_Q9P0T4_ZN581_HUMAN:84:193_5egb_A_1
5 2i13 84:197 85 193 P:A · DNA:C,D 37.6% / 54.1% 70 View · PDB TFS_sp_Q9P0T4_ZN581_HUMAN:85:193_2i13_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
87-109PF00096Zinc finger, C2H2 typeoverlaps 84-197
115-137PF00096Zinc finger, C2H2 typeoverlaps 84-197
147-167PF00096Zinc finger, C2H2 typeoverlaps 84-197
173-196PF13894C2H2-type zinc fingeroverlaps 84-197