ModCRE DB

Transcription factor

Q9P1Z0 - ZBTB4

Zinc finger and BTB domain-containing protein 4 (KAISO-like zinc finger protein 1) (KAISO-L1)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1013 aa

15 Generated PWM 10 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)8
MotifPredictionSourceDNA bindingSupportLogoActions
MA0527.1 NN 70-40% JASPAR CTCTCGCGAGATCTG 57.2% identity Open · Scan
M08864_2.00 NN 70-40% CisBP CCTCCCCCCCCGCCCCCTCCCC 55.5% identity Open · Scan
M04434_2.00 NN 70-40% CisBP GCTATAGGTGA 54.3% identity Open · Scan
M00775_2.00 NN 70-40% CisBP GTCCCGCAAC 51.0% identity Open · Scan
MA0591.1 NN 70-40% JASPAR AGGATGACTCAGCAC 50.0% identity Open · Scan
MA0695.1 NN 70-40% JASPAR GCGACCACCGAA 50.0% identity Open · Scan
MA0750.1 NN 70-40% JASPAR GGCGACCACCGA 50.0% identity Open · Scan
MA1633.1 NN 70-40% JASPAR GATGACTCAGCAA 50.0% identity Open · Scan
ModCRE7
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_4f6m_A_1 ModCRE Homology model GGATCCCGGTAAGGGT Region 297-392 · 1 3D model Open · Scan
TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_5vmv_A_1 ModCRE Homology model ACGATTCCCGTAAGGA Region 297-392 · 1 3D model Open · Scan
TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_6df5_A_1 ModCRE Homology model GGTTCCCAGAAAGGG Region 297-392 · 1 3D model Open · Scan
TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_6df8_A_1 ModCRE Homology model GGATCCCCATAAAAT Region 297-392 · 1 3D model Open · Scan
TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_6dfc_A_1 ModCRE Homology model GGTTCCCAGAAAGGG Region 297-392 · 1 3D model Open · Scan
TFS_sp_Q9P1Z0_ZBTB4_HUMAN:726:750_5t0u_A_1 ModCRE Homology model TATGCGCCGATA Region 726-750 · 1 3D model Open · Scan
TFS_sp_Q9P1Z0_ZBTB4_HUMAN:765:792_5yef_A_1 ModCRE Homology model AATGATGAAAAT Region 765-792 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1013 aa
297-392
726-750
765-792

Region 297-392 5 PWM

Residues
96 aa
Domains
No overlapping PFAM annotation recorded
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 4F6M, 5VMV, 6DF5, 6DF8, 6DFC
Sources
Predicted = Low
Scan this region Show models

Region 726-750 1 PWM

Residues
25 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
5T0U
Sources
Predicted = Low
Scan this region Show models

Region 765-792 1 PWM

Residues
28 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
3 active PDBs
Templates
5YEF
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
10 active PDB models 6 summary rows
Region 297-3926 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q9P1Z0_ZBTB4_HUMAN:335:388_1llm_D_1 1llm 335-388 View model · PDB
Predicted = Low TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_4f6m_A_1 4f6m 297-392 View model · PDB
Predicted = Low TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_5vmv_A_1 5vmv 297-392 View model · PDB
Predicted = Low TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_6df5_A_1 6df5 297-392 View model · PDB
Predicted = Low TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_6df8_A_1 6df8 297-392 View model · PDB
Predicted = Low TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_6dfc_A_1 6dfc 297-392 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6df5 291:392 297 392 P:A · DNA:D,E 57.3% / 75.0% 82 View · PDB TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_6df5_A_1
2 5vmv 291:392 297 392 P:A · DNA:D,E 57.3% / 75.0% 82 View · PDB TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_5vmv_A_1
3 4f6m 291:392 297 392 P:A · DNA:D,E 57.3% / 75.0% 82 View · PDB TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_4f6m_A_1
4 6dfc 291:392 297 392 P:A · DNA:D,E 57.3% / 75.0% 82 View · PDB TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_6dfc_A_1
5 6df8 291:392 297 392 P:A · DNA:D,E 57.3% / 75.0% 81 View · PDB TFS_sp_Q9P1Z0_ZBTB4_HUMAN:297:392_6df8_A_1
1 1llm 291:392 335,335 388,388 P:C,D · DNA:A,B 29.6% / 48.1% 62,63 View · PDB DIMER_sp_Q9P1Z0_ZBTB4_HUMAN:335:388_1llm_D_1
Region 726-7501 model
Actions
Predicted = Low TFS_sp_Q9P1Z0_ZBTB4_HUMAN:726:750_5t0u_A_1 5t0u 726-750 View model · PDB
Region 765-7923 models
Actions
Predicted = Low TFS_sp_Q9P1Z0_ZBTB4_HUMAN:765:792_5yef_A_1 5yef 765-792 View model · PDB
Predicted = Low TFS_sp_Q9P1Z0_ZBTB4_HUMAN:765:792_5yef_B_1 5yef 765-792 View model · PDB
Predicted = Low TFS_sp_Q9P1Z0_ZBTB4_HUMAN:765:792_5yef_J_1 5yef 765-792 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
20-60PF00651BTB/POZ domainNo overlap with loaded model regions
235-252PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
765-787PF00096Zinc finger, C2H2 typeoverlaps 765-792