ModCRE DB

Transcription factor

Q9P2F9 - ZNF319

Zinc finger protein 319

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 582 aa

22 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)16
MotifPredictionSourceDNA bindingSupportLogoActions
M00960_2.00 NN 70-40% CisBP TGCATCCC 58.3% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 57.1% identity Open · Scan
M07625_2.00 NN 70-40% CisBP TCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 56.6% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 55.9% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 55.9% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 55.9% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 55.9% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 54.7% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 53.5% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 53.5% identity Open · Scan
M01529_2.00 NN 70-40% CisBP CCCCGCATT 52.7% identity Open · Scan
M00645_2.00 NN 70-40% CisBP CGCCCACGCA 52.6% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 51.1% identity Open · Scan
M08864_2.00 NN 70-40% CisBP CCTCCCCCCCCGCCCCCTCCCC 50.7% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 50.0% identity Open · Scan
M01868_2.00 NN 70-40% CisBP TCTTGGCG 50.0% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q9P2F9_ZN319_HUMAN:228:276_1llm_C_1 ModCRE Homology model CGGGCGCGCCGC Region 228-276 · 1 3D model Open · Scan
TFS_sp_Q9P2F9_ZN319_HUMAN:200:446_8ssr_A_1 ModCRE Homology model TCGGGGGGGCCGCGCAAGCATGCTGCTGAGAAGTT Region 200-446 · 1 3D model Open · Scan
TFS_sp_Q9P2F9_ZN319_HUMAN:229:509_5v3j_E_1 ModCRE Homology model TCCGTGCCCCCCGTGTCGGGCGGGGA Region 229-509 · 1 3D model Open · Scan
TFS_sp_Q9P2F9_ZN319_HUMAN:229:509_5v3m_C_1 ModCRE Homology model CCCCCCCCCGTGGGACCGGCCCCCCG Region 229-509 · 1 3D model Open · Scan
TFS_sp_Q9P2F9_ZN319_HUMAN:254:536_5wjq_D_1 ModCRE Homology model TCCCCCCCCCTGCCCCGGGCCCCCCCAC Region 254-536 · 1 3D model Open · Scan
TFS_sp_Q9P2F9_ZN319_HUMAN:258:532_7w1m_H_1 ModCRE Homology model TCGGGCCTGAGGAAGTTTCTTCCCTGCTGCTTGGCTTACGTT Region 258-532 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 582 aa
200-536

Region 200-536 6 PWM

Residues
337 aa
Domains
PF13465 · Zinc-finger double domain PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 5V3J, 5V3M, 5WJQ, 7W1M, 8SSR
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 200-5366 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q9P2F9_ZN319_HUMAN:228:276_1llm_C_1 1llm 228-276 View model · PDB
Predicted = Low TFS_sp_Q9P2F9_ZN319_HUMAN:200:446_8ssr_A_1 8ssr 200-446 View model · PDB
Predicted = Low TFS_sp_Q9P2F9_ZN319_HUMAN:229:509_5v3j_E_1 5v3j 229-509 View model · PDB
Predicted = Low TFS_sp_Q9P2F9_ZN319_HUMAN:229:509_5v3m_C_1 5v3m 229-509 View model · PDB
Predicted = Low TFS_sp_Q9P2F9_ZN319_HUMAN:254:536_5wjq_D_1 5wjq 254-536 View model · PDB
Predicted = Low TFS_sp_Q9P2F9_ZN319_HUMAN:258:532_7w1m_H_1 7w1m 258-532 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 198:564 228,228 276,276 P:C,D · DNA:A,B 40.8% / 63.3% 56,57 View · PDB DIMER_sp_Q9P2F9_ZN319_HUMAN:228:276_1llm_C_1
1 5wjq 198:564 254 536 P:D · DNA:A,B 40.3% / 54.8% 99 View · PDB TFS_sp_Q9P2F9_ZN319_HUMAN:254:536_5wjq_D_1
2 5v3m 198:564 229 509 P:C · DNA:A,B 38.8% / 53.7% 100 View · PDB TFS_sp_Q9P2F9_ZN319_HUMAN:229:509_5v3m_C_1
3 5v3j 198:564 229 509 P:E · DNA:A,B 38.8% / 53.7% 100 View · PDB TFS_sp_Q9P2F9_ZN319_HUMAN:229:509_5v3j_E_1
5 8ssr 198:564 200 446 P:A · DNA:B,C 35.3% / 49.4% 94 View · PDB TFS_sp_Q9P2F9_ZN319_HUMAN:200:446_8ssr_A_1
4 7w1m 198:564 258 532 P:H · DNA:F,G 32.9% / 48.4% 85 View · PDB TFS_sp_Q9P2F9_ZN319_HUMAN:258:532_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
216-241PF13465Zinc-finger double domainoverlaps 200-536
258-280PF00096Zinc finger, C2H2 typeoverlaps 200-536
315-337PF00096Zinc finger, C2H2 typeoverlaps 200-536
343-365PF00096Zinc finger, C2H2 typeoverlaps 200-536
371-393PF00096Zinc finger, C2H2 typeoverlaps 200-536
399-418PF00096Zinc finger, C2H2 typeoverlaps 200-536
428-450PF00096Zinc finger, C2H2 typeoverlaps 200-536
501-525PF13465Zinc-finger double domainoverlaps 200-536