Region 1-318 1 PWM
- Residues
- 318 aa
- Domains
- PF05053 · Menin PF05053 · Menin
- 3D models
- 1 active PDB · 1 summary row
- Templates
- 8GPN
- Sources
- Predicted = Low
Transcription factor
Q9UE24
Menin
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 341 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_tr_Q9UE24_Q9UE24_HUMAN:1:318_8gpn_K_1 | ModCRE | Homology model | CACCGCCCCCCGGGGTAAAAAATCAAATTAAAA | Region 1-318 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
341 aa
1-318
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
1 summary row
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 1-3181 model · 1 summary row
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_tr_Q9UE24_Q9UE24_HUMAN:1:318_8gpn_K_1 | 8gpn | 1-318 | View model · PDB |
Model-summary evidence imported for this region.
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 1-230 | PF05053 | Menin | overlaps 1-318 |
| 279-339 | PF05053 | Menin | overlaps 1-318 |