ModCRE DB

Transcription factor

Q9UIE0 - ZNF230

Zinc finger protein 230 (Zinc finger protein FDZF2)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 474 aa

31 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07654_2.00 NN 70+% CisBP TGCCCCCTGGTGGC 78.3% identity Open · Scan
Nearest Neighbor (70% - 40%)30
MotifPredictionSourceDNA bindingSupportLogoActions
M08399_2.00 NN 70-40% CisBP TACTCTGGGGCCACATGACTC 62.5% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 59.5% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 59.5% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 59.0% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 57.8% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 57.8% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 57.8% identity Open · Scan
M07679_2.00 NN 70-40% CisBP TGCGATCTC 57.7% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 56.6% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 56.6% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 56.6% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 55.9% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 55.9% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 55.9% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 55.7% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 55.4% identity Open · Scan
M04465_2.00 NN 70-40% CisBP GTGATTCTTATCTTATCCTT 53.9% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 53.7% identity Open · Scan
M04505_2.00 NN 70-40% CisBP AGCTTTTCCCACAC 53.6% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 53.2% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 53.1% identity Open · Scan
M08314_2.00 NN 70-40% CisBP ATTCATCAAGGTCCTCAACAATGG 53.0% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 52.7% identity Open · Scan
MA1602.1 NN 70-40% JASPAR CGTCTACACGGG 51.6% identity Open · Scan
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 51.1% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 51.0% identity Open · Scan
M07678_2.00 NN 70-40% CisBP CCCGCCCCCTCCTCCCCCTTCCCACCC 51.0% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 50.9% identity Open · Scan
M04613_2.00 NN 70-40% CisBP CTCATGTGCTAATTACAAA 50.7% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 50.4% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 474 aa
165-442

Region 165-442 0 PWM

Residues
278 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 165-4421 model
Actions
Predicted = Low TFS_Q9UIE0:165:442_5wjq_D_1 5wjq 165-442 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
8-48PF01352KRAB boxNo overlap with loaded model regions
168-190PF00096Zinc finger, C2H2 typeoverlaps 165-442
252-274PF00096Zinc finger, C2H2 typeoverlaps 165-442
280-302PF00096Zinc finger, C2H2 typeoverlaps 165-442
336-358PF00096Zinc finger, C2H2 typeoverlaps 165-442
364-386PF00096Zinc finger, C2H2 typeoverlaps 165-442
392-414PF00096Zinc finger, C2H2 typeoverlaps 165-442