ModCRE DB

Transcription factor

Q9UK12 - ZNF222

Zinc finger protein 222

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 451 aa

22 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07604_2.00 Known CisBP GCTGACATC Direct PWM Open · Scan
Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07654_2.00 NN 70+% CisBP TGCCCCCTGGTGGC 74.1% identity Open · Scan
Nearest Neighbor (70% - 40%)20
MotifPredictionSourceDNA bindingSupportLogoActions
M08399_2.00 NN 70-40% CisBP TACTCTGGGGCCACATGACTC 59.3% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 57.8% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 56.6% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 56.6% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 56.3% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 55.7% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 55.4% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 55.4% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 55.4% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 55.4% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 54.2% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 54.2% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 54.2% identity Open · Scan
M07679_2.00 NN 70-40% CisBP TGCGATCTC 53.7% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 53.0% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 52.1% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.9% identity Open · Scan
M08314_2.00 NN 70-40% CisBP ATTCATCAAGGTCCTCAACAATGG 50.9% identity Open · Scan
M04505_2.00 NN 70-40% CisBP AGCTTTTCCCACAC 50.7% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 451 aa
116-391

Region 116-391 0 PWM

Residues
276 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 116-3911 model
Actions
Predicted = Low TFS_Q9UK12:116:391_5v3j_E_1 5v3j 116-391 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
8-48PF01352KRAB boxNo overlap with loaded model regions
145-167PF00096Zinc finger, C2H2 typeoverlaps 116-391
173-195PF00096Zinc finger, C2H2 typeoverlaps 116-391
229-251PF00096Zinc finger, C2H2 typeoverlaps 116-391
257-279PF00096Zinc finger, C2H2 typeoverlaps 116-391
313-335PF00096Zinc finger, C2H2 typeoverlaps 116-391
341-363PF00096Zinc finger, C2H2 typeoverlaps 116-391
369-391PF00096Zinc finger, C2H2 typeoverlaps 116-391