ModCRE DB

Transcription factor

Q9UK13 - ZNF221

Zinc finger protein 221

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 617 aa

41 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08399_2.00 NN 70+% CisBP TACTCTGGGGCCACATGACTC 82.0% identity Open · Scan
Nearest Neighbor (70% - 40%)40
MotifPredictionSourceDNA bindingSupportLogoActions
M07679_2.00 NN 70-40% CisBP TGCGATCTC 69.0% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 65.8% identity Open · Scan
M07654_2.00 NN 70-40% CisBP TGCCCCCTGGTGGC 63.8% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 61.1% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 60.0% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 60.0% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 60.0% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 60.0% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 60.0% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 59.4% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 58.8% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 58.8% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 57.6% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 57.6% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 56.1% identity Open · Scan
M08901_2.00 NN 70-40% CisBP CCAGTTCACACC 55.3% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 55.1% identity Open · Scan
M04653_2.00 NN 70-40% CisBP GGTACGGTTGTCCATGTTGCAA 54.8% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 54.0% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 53.9% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 53.9% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 53.1% identity Open · Scan
M08267_2.00 NN 70-40% CisBP CAGTTTCATTTTCC 52.6% identity Open · Scan
M07649_2.00 NN 70-40% CisBP CCCCCCCCCCCCTCAGGAATGCC 52.3% identity Open · Scan
M08254_2.00 NN 70-40% CisBP CTGCCCTGGGACTTT 52.2% identity Open · Scan
M08355_2.00 NN 70-40% CisBP GCGAACTCCTATTCATCC 52.2% identity Open · Scan
M08295_2.00 NN 70-40% CisBP CTGCTGGAATCTCCA 51.8% identity Open · Scan
MA1602.1 NN 70-40% JASPAR CGTCTACACGGG 51.5% identity Open · Scan
M08334_2.00 NN 70-40% CisBP TTTGTTTTTTTCTGATTGCTTTTTACTTAT 51.4% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 51.1% identity Open · Scan
M04465_2.00 NN 70-40% CisBP GTGATTCTTATCTTATCCTT 51.0% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 50.9% identity Open · Scan
M08263_2.00 NN 70-40% CisBP ATCTCGGCACTTTGGGAGGCCA 50.9% identity Open · Scan
M07581_2.00 NN 70-40% CisBP TCCCCTGTGCTTCTCTCCCCT 50.7% identity Open · Scan
M08373_2.00 NN 70-40% CisBP CCCCCTGGCTCTTCCTCT 50.7% identity Open · Scan
MA1656.1 NN 70-40% JASPAR CCAAGCCCAACCAG 50.7% identity Open · Scan
M00786_2.00 NN 70-40% CisBP TATATATAT 50.5% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 50.4% identity Open · Scan
M00782_2.00 NN 70-40% CisBP AGTGTGCGCTA 50.3% identity Open · Scan
M00217_2.00 NN 70-40% CisBP TTACTCAATAT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 617 aa
226-356

Region 226-356 0 PWM

Residues
131 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 226-3561 model
Actions
Predicted = Low TFS_Q9UK13:226:356_5t0u_A_1 5t0u 226-356 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
30-70PF01352KRAB boxNo overlap with loaded model regions
198-220PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
226-248PF00096Zinc finger, C2H2 typeoverlaps 226-356
282-304PF00096Zinc finger, C2H2 typeoverlaps 226-356
310-332PF00096Zinc finger, C2H2 typeoverlaps 226-356
338-360PF00096Zinc finger, C2H2 typeoverlaps 226-356
394-416PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
422-444PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
450-472PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
478-500PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
506-525PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
534-556PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
562-584PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions