Transcription factor

Q9UK33 - ZNF580

Zinc finger protein 580 (LDL-induced EC protein)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 172 aa

6 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known6

Motif	Prediction	Source	DNA binding	Support	Actions
M04642_2.00	Known	CisBP	CATTATGTTAAATTATTACCCTA	Direct PWM	Open · Scan
M04637_2.00	Known	CisBP	CCTACCCTCACCTACCCT	Direct PWM	Open · Scan
M04638_2.00	Known	CisBP	CCTACCCTCGCCTACCCT	Direct PWM	Open · Scan
M04639_2.00	Known	CisBP	CCTACCCTCCACCTACCCT	Direct PWM	Open · Scan
M04640_2.00	Known	CisBP	TGTTATGTTAAATAATTACCCTA	Direct PWM	Open · Scan
M04641_2.00	Known	CisBP	CCTACCCTCCCCCTACCCT	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 172 aa

87-172

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 87-1721 model

				Actions
Predicted = Low	TFS_Q9UK33:87:172_5wjq_D_1	5wjq	87-172	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
120-142	PF00096	Zinc finger, C2H2 type	overlaps 87-172
150-172	PF00096	Zinc finger, C2H2 type	overlaps 87-172