ModCRE DB

Transcription factor

Q9ULJ3 - ZBTB21

Zinc finger and BTB domain-containing protein 21 (Zinc finger protein 295)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1066 aa

11 Generated PWM 9 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M08367_2.00 NN 70-40% CisBP GGGGTGATGACCACTCTGGCTTCTTAC 55.1% identity Open · Scan
M08864_2.00 NN 70-40% CisBP CCTCCCCCCCCGCCCCCTCCCC 54.0% identity Open · Scan
ModCRE9
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q9ULJ3_ZBT21_HUMAN:544:598_1llm_C_1 ModCRE Homology model CCCCCCCGGGGC Region 544-598 · 1 3D model Open · Scan
TFS_sp_Q9ULJ3_ZBT21_HUMAN:1038:1065_5egb_A_1 ModCRE Homology model CGGGGGCGCCCCC Region 1038-1065 · 1 3D model Open · Scan
TFS_sp_Q9ULJ3_ZBT21_HUMAN:1038:1065_5eh2_F_1 ModCRE Homology model GGGACCCCCCCT Region 1038-1065 · 1 3D model Open · Scan
TFS_sp_Q9ULJ3_ZBT21_HUMAN:1038:1065_5ei9_E_1 ModCRE Homology model CGGGCCCCCCCCT Region 1038-1065 · 1 3D model Open · Scan
TFS_sp_Q9ULJ3_ZBT21_HUMAN:909:959_7txc_E_1 ModCRE Homology model CGGGTGTGCCGCCA Region 909-959 · 1 3D model Open · Scan
TFS_sp_Q9ULJ3_ZBT21_HUMAN:909:962_6e93_A_1 ModCRE Homology model GCGGATCCCAGCGCC Region 909-962 · 1 3D model Open · Scan
TFS_sp_Q9ULJ3_ZBT21_HUMAN:909:962_6e94_A_1 ModCRE Homology model GCGGGGCCCCCGTCC Region 909-962 · 1 3D model Open · Scan
TFS_sp_Q9ULJ3_ZBT21_HUMAN:911:959_8a4i_I_1 ModCRE Homology model GCCAGCAGCGG Region 911-959 · 1 3D model Open · Scan
TFS_sp_Q9ULJ3_ZBT21_HUMAN:911:959_8cuc_F_1 ModCRE Homology model GGTTGGGCTTGT Region 911-959 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1066 aa
544-598
909-962
1038-1065

Region 544-598 1 PWM

Residues
55 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB · 1 summary row
Templates
1LLM
Sources
Predicted = Low
Scan this region Show models

Region 909-962 5 PWM

Residues
54 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
5 active PDBs · 5 summary rows
Templates
6E93, 6E94, 7TXC, 8A4I, 8CUC
Sources
Predicted = Low
Scan this region Show models

Region 1038-1065 3 PWM

Residues
28 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
3 active PDBs
Templates
5EGB, 5EH2, 5EI9
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
9 active PDB models 6 summary rows
Region 544-5981 model · 1 summary row
Actions
Predicted = Low DIMER_sp_Q9ULJ3_ZBT21_HUMAN:544:598_1llm_C_1 1llm 544-598 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 909:962 544,544 598,598 P:C,D · DNA:A,B 36.4% / 56.4% 62,63 View · PDB DIMER_sp_Q9ULJ3_ZBT21_HUMAN:544:598_1llm_C_1
Region 909-9625 models · 5 summary rows
Actions
Predicted = Low TFS_sp_Q9ULJ3_ZBT21_HUMAN:909:959_7txc_E_1 7txc 909-959 View model · PDB
Predicted = Low TFS_sp_Q9ULJ3_ZBT21_HUMAN:909:962_6e93_A_1 6e93 909-962 View model · PDB
Predicted = Low TFS_sp_Q9ULJ3_ZBT21_HUMAN:909:962_6e94_A_1 6e94 909-962 View model · PDB
Predicted = Low TFS_sp_Q9ULJ3_ZBT21_HUMAN:911:959_8a4i_I_1 8a4i 911-959 View model · PDB
Predicted = Low TFS_sp_Q9ULJ3_ZBT21_HUMAN:911:959_8cuc_F_1 8cuc 911-959 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 7txc 909:962 909 959 P:E · DNA:A,B 39.2% / 49.0% 60 View · PDB TFS_sp_Q9ULJ3_ZBT21_HUMAN:909:959_7txc_E_1
1 6e94 909:962 909 962 P:A · DNA:C,D 37.0% / 57.4% 48 View · PDB TFS_sp_Q9ULJ3_ZBT21_HUMAN:909:962_6e94_A_1
2 8cuc 909:962 911 959 P:F · DNA:A,B 36.7% / 57.1% 90 View · PDB TFS_sp_Q9ULJ3_ZBT21_HUMAN:911:959_8cuc_F_1
3 8a4i 909:962 911 959 P:I · DNA:A,B 36.7% / 57.1% 90 View · PDB TFS_sp_Q9ULJ3_ZBT21_HUMAN:911:959_8a4i_I_1
4 6e93 909:962 909 962 P:A · DNA:C,D 35.2% / 57.4% 48 View · PDB TFS_sp_Q9ULJ3_ZBT21_HUMAN:909:962_6e93_A_1
Region 1038-10653 models
Actions
Predicted = Low TFS_sp_Q9ULJ3_ZBT21_HUMAN:1038:1065_5egb_A_1 5egb 1038-1065 View model · PDB
Predicted = Low TFS_sp_Q9ULJ3_ZBT21_HUMAN:1038:1065_5eh2_F_1 5eh2 1038-1065 View model · PDB
Predicted = Low TFS_sp_Q9ULJ3_ZBT21_HUMAN:1038:1065_5ei9_E_1 5ei9 1038-1065 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
20-120PF00651BTB/POZ domainNo overlap with loaded model regions
670-692PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
746-773PF18450Zinc Finger domainNo overlap with loaded model regions
910-928PF00096Zinc finger, C2H2 typeoverlaps 909-962
1043-1065PF00096Zinc finger, C2H2 typeoverlaps 1038-1065