Region 196-306 0 PWM
- Residues
- 111 aa
- Domains
- PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
- 3D models
- 1 active PDB
- Templates
- 6E93
- Sources
- Structure model
Transcription factor
Q9Y2A4 - ZNF443
Zinc finger protein 443 (Krueppel-type zinc finger protein ZK1)
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 671 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M07659_2.00 | Known | CisBP | GTCTTCCAAGTAGCTGGTGTT | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
671 aa
196-306
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 196-3061 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_Q9Y2A4:196:306_6e93_A_1 | 6e93 | 196-306 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 3-42 | PF01352 | KRAB box | No overlap with loaded model regions |
| 169-189 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 225-247 | PF00096 | Zinc finger, C2H2 type | overlaps 196-306 |
| 253-275 | PF00096 | Zinc finger, C2H2 type | overlaps 196-306 |
| 309-331 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 337-359 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 365-387 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 393-415 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 421-443 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 449-471 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 504-526 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 532-554 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 588-610 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 616-641 | PF13912 | C2H2-type zinc finger | No overlap with loaded model regions |
| 649-671 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |