ModCRE DB

Transcription factor

Q9Y462 - ZNF711

Zinc finger protein 711 (Zinc finger protein 6)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 761 aa

16 Generated PWM 12 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M09508_2.00 Known CisBP CTAGGCCT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)5
MotifPredictionSourceDNA bindingSupportLogoActions
M07625_2.00 NN 70-40% CisBP TCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 57.5% identity Open · Scan
MA0146.1 NN 70-40% JASPAR GGGGCCGAGGCCTG 55.9% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 53.1% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 51.0% identity Open · Scan
M06802_2.00 NN 70-40% CisBP ACCTTCCCCAGATAA 50.0% identity Open · Scan
ModCRE10
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q9Y462_ZN711_HUMAN:395:417_1hcq_B_1 ModCRE Homology model AAGGCAAGGTGTCACCT Region 395-417 · 1 3D model Open · Scan
TFS_sp_Q9Y462_ZN711_HUMAN:385:436_3uk3_C_1 ModCRE Homology model GCCGGGTCAAT Region 385-436 · 1 3D model Open · Scan
TFS_sp_Q9Y462_ZN711_HUMAN:385:436_3uk3_D_1 ModCRE Homology model TCATCACCGC Region 385-436 · 1 3D model Open · Scan
TFS_sp_Q9Y462_ZN711_HUMAN:385:436_4is1_C_1 ModCRE Homology model GCCGGTGAAAT Region 385-436 · 1 3D model Open · Scan
TFS_sp_Q9Y462_ZN711_HUMAN:385:436_4is1_D_1 ModCRE Homology model GTGTTCAAGC Region 385-436 · 1 3D model Open · Scan
TFS_sp_Q9Y462_ZN711_HUMAN:385:436_5yj3_C_1 ModCRE Homology model GGCCA Region 385-436 · 1 3D model Open · Scan
TFS_sp_Q9Y462_ZN711_HUMAN:474:755_5wjq_D_1 ModCRE Homology model GGGCCCCGCCACCTGCCCCGGGCCCCCC Region 474-755 · 1 3D model Open · Scan
TFS_sp_Q9Y462_ZN711_HUMAN:476:698_8ssu_A_1 ModCRE Homology model CGCCGCCGGAGATGCGATG Region 476-698 · 1 3D model Open · Scan
TFS_sp_Q9Y462_ZN711_HUMAN:504:758_5v3j_E_1 ModCRE Homology model GGGAACAGTGTCCCCTAAGGGTA Region 504-758 · 1 3D model Open · Scan
TFS_sp_Q9Y462_ZN711_HUMAN:504:758_5v3m_C_1 ModCRE Homology model CCCCCCCGACCCCGTGCCCCCCTC Region 504-758 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 761 aa
385-436
474-758

Region 385-436 6 PWM

Residues
52 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs
Templates
1HCQ, 3UK3, 4IS1, 5YJ3
Sources
Predicted = Low
Scan this region Show models

Region 474-758 4 PWM

Residues
285 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 5V3J, 5V3M, 5WJQ, 7W1M, 8SSU
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
12 active PDB models 6 summary rows
Region 385-4366 models
Actions
Predicted = Low DIMER_sp_Q9Y462_ZN711_HUMAN:395:417_1hcq_B_1 1hcq 395-417 View model · PDB
Predicted = Low TFS_sp_Q9Y462_ZN711_HUMAN:385:436_3uk3_C_1 3uk3 385-436 View model · PDB
Predicted = Low TFS_sp_Q9Y462_ZN711_HUMAN:385:436_3uk3_D_1 3uk3 385-436 View model · PDB
Predicted = Low TFS_sp_Q9Y462_ZN711_HUMAN:385:436_4is1_C_1 4is1 385-436 View model · PDB
Predicted = Low TFS_sp_Q9Y462_ZN711_HUMAN:385:436_4is1_D_1 4is1 385-436 View model · PDB
Predicted = Low TFS_sp_Q9Y462_ZN711_HUMAN:385:436_5yj3_C_1 5yj3 385-436 View model · PDB
Region 474-7586 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q9Y462_ZN711_HUMAN:504:556_1llm_D_1 1llm 504-556 View model · PDB
Predicted = Low TFS_sp_Q9Y462_ZN711_HUMAN:474:755_5wjq_D_1 5wjq 474-755 View model · PDB
Predicted = Low TFS_sp_Q9Y462_ZN711_HUMAN:476:698_8ssu_A_1 8ssu 476-698 View model · PDB
Predicted = Low TFS_sp_Q9Y462_ZN711_HUMAN:477:756_7w1m_H_1 7w1m 477-756 View model · PDB
Predicted = Low TFS_sp_Q9Y462_ZN711_HUMAN:504:758_5v3j_E_1 5v3j 504-758 View model · PDB
Predicted = Low TFS_sp_Q9Y462_ZN711_HUMAN:504:758_5v3m_C_1 5v3m 504-758 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 474:758 504,504 556,556 P:C,D · DNA:A,B 37.7% / 47.2% 60,62 View · PDB DIMER_sp_Q9Y462_ZN711_HUMAN:504:556_1llm_D_1
1 5v3m 474:758 504 758 P:C · DNA:A,B 36.9% / 50.6% 90 View · PDB TFS_sp_Q9Y462_ZN711_HUMAN:504:758_5v3m_C_1
2 5v3j 474:758 504 758 P:E · DNA:A,B 36.9% / 50.6% 90 View · PDB TFS_sp_Q9Y462_ZN711_HUMAN:504:758_5v3j_E_1
3 5wjq 474:758 474 755 P:D · DNA:A,B 35.8% / 50.7% 98 View · PDB TFS_sp_Q9Y462_ZN711_HUMAN:474:755_5wjq_D_1
5 8ssu 474:758 476 698 P:A · DNA:B,C 32.3% / 44.7% 94 View · PDB TFS_sp_Q9Y462_ZN711_HUMAN:476:698_8ssu_A_1
4 7w1m 474:758 477 756 P:H · DNA:F,G 29.3% / 48.8% 86 View · PDB TFS_sp_Q9Y462_ZN711_HUMAN:477:756_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
66-305PF04704Zfx/Zfy transcription activation regionNo overlap with loaded model regions
320-368PF04704Zfx/Zfy transcription activation regionNo overlap with loaded model regions
383-405PF00096Zinc finger, C2H2 typeoverlaps 385-436
505-527PF00096Zinc finger, C2H2 typeoverlaps 474-758
562-581PF00096Zinc finger, C2H2 typeoverlaps 474-758
590-613PF00096Zinc finger, C2H2 typeoverlaps 474-758
619-641PF00096Zinc finger, C2H2 typeoverlaps 474-758
677-698PF00096Zinc finger, C2H2 typeoverlaps 474-758