ModCRE DB

Transcription factor

Q9Y467 - SALL2

Sal-like protein 2 (Zinc finger protein 795) (Zinc finger protein SALL2) (Zinc finger protein Spalt-2) (Sal-2) (hSal2)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1007 aa

28 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)21
MotifPredictionSourceDNA bindingSupportLogoActions
M08979_2.00 NN 70-40% CisBP CCCACCCTCC 68.4% identity Open · Scan
M00641_2.00 NN 70-40% CisBP ATTGACCACT 60.0% identity Open · Scan
M03702_2.00 NN 70-40% CisBP GACCCCCCACGACGC 56.6% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 54.7% identity Open · Scan
M07667_2.00 NN 70-40% CisBP CCGCACAGGCCCCCGGGCCCC 54.7% identity Open · Scan
M01022_2.00 NN 70-40% CisBP GGACCACCCAC 53.8% identity Open · Scan
M01024_2.00 NN 70-40% CisBP GGACCACCCA 53.8% identity Open · Scan
MA0734.1 NN 70-40% JASPAR GCGACCACACTG 53.8% identity Open · Scan
M08252_2.00 NN 70-40% CisBP CCGGCTCCAGCACCC 52.8% identity Open · Scan
M00954_2.00 NN 70-40% CisBP CTACCCTA 52.5% identity Open · Scan
M08254_2.00 NN 70-40% CisBP CTGCCCTGGGACTTT 51.2% identity Open · Scan
M00608_2.00 NN 70-40% CisBP CCTGTTG 51.0% identity Open · Scan
M03691_2.00 NN 70-40% CisBP ATGCAACAGGTGG 50.9% identity Open · Scan
M06087_2.00 NN 70-40% CisBP ACCACCTGTTGCA 50.9% identity Open · Scan
M10203_2.00 NN 70-40% CisBP CCCCAAACCACCCC 50.8% identity Open · Scan
MA0073.1 NN 70-40% JASPAR CCCCAAACCACCCCCCCCCA 50.8% identity Open · Scan
M00765_2.00 NN 70-40% CisBP CCCGCCCCC 50.0% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 50.0% identity Open · Scan
M05859_2.00 NN 70-40% CisBP GGCCACGCCCACT 50.0% identity Open · Scan
MA0685.1 NN 70-40% JASPAR TAAGCCACGCCCCCTTT 50.0% identity Open · Scan
MA0744.1 NN 70-40% JASPAR ATGCAACAGGTGG 50.0% identity Open · Scan
ModCRE7
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q9Y467_SALL2_HUMAN:372:423_8a4i_I_1 ModCRE Homology model CGCCCCGACCG Region 372-423 · 1 3D model Open · Scan
TFS_sp_Q9Y467_SALL2_HUMAN:372:423_8cuc_F_1 ModCRE Homology model AACTCCCCCCCC Region 372-423 · 1 3D model Open · Scan
TFS_sp_Q9Y467_SALL2_HUMAN:374:430_7n5u_A_1 ModCRE Homology model TTGTCGAAAT Region 374-430 · 1 3D model Open · Scan
TFS_sp_Q9Y467_SALL2_HUMAN:630:715_6e93_A_1 ModCRE Homology model GCCGGCGGCGAGGGTG Region 630-715 · 1 3D model Open · Scan
TFS_sp_Q9Y467_SALL2_HUMAN:630:715_6e94_A_1 ModCRE Homology model GACCGCGGCCGGGGTG Region 630-715 · 1 3D model Open · Scan
TFS_sp_Q9Y467_SALL2_HUMAN:692:715_1f2i_G_1 ModCRE Homology model CGGGCGTCCTG Region 692-715 · 1 3D model Open · Scan
TFS_sp_Q9Y467_SALL2_HUMAN:692:715_1f2i_H_1 ModCRE Homology model TTAAAGTCTCG Region 692-715 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1007 aa
372-430
630-715

Region 372-430 3 PWM

Residues
59 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
4 active PDBs · 4 summary rows
Templates
1LLM, 7N5U, 8A4I, 8CUC
Sources
Predicted = Low
Scan this region Show models

Region 630-715 4 PWM

Residues
86 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
4 active PDBs · 2 summary rows
Templates
1F2I, 6E93, 6E94
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 6 summary rows
Region 372-4304 models · 4 summary rows
Actions
Predicted = Low DIMER_sp_Q9Y467_SALL2_HUMAN:374:419_1llm_D_1 1llm 374-419 View model · PDB
Predicted = Low TFS_sp_Q9Y467_SALL2_HUMAN:372:423_8a4i_I_1 8a4i 372-423 View model · PDB
Predicted = Low TFS_sp_Q9Y467_SALL2_HUMAN:372:423_8cuc_F_1 8cuc 372-423 View model · PDB
Predicted = Low TFS_sp_Q9Y467_SALL2_HUMAN:374:430_7n5u_A_1 7n5u 374-430 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 8cuc 370:442 372 423 P:F · DNA:A,B 61.5% / 75.0% 96 View · PDB TFS_sp_Q9Y467_SALL2_HUMAN:372:423_8cuc_F_1
2 8a4i 370:442 372 423 P:I · DNA:A,B 61.5% / 75.0% 96 View · PDB TFS_sp_Q9Y467_SALL2_HUMAN:372:423_8a4i_I_1
5 7n5u 370:442 374 430 P:A · DNA:X,Y 45.6% / 63.2% 69 View · PDB TFS_sp_Q9Y467_SALL2_HUMAN:374:430_7n5u_A_1
1 1llm 370:442 374,374 419,419 P:C,D · DNA:A,B 39.1% / 58.7% 52,54 View · PDB DIMER_sp_Q9Y467_SALL2_HUMAN:374:419_1llm_D_1
Region 630-7154 models · 2 summary rows
Actions
Predicted = Low TFS_sp_Q9Y467_SALL2_HUMAN:630:715_6e93_A_1 6e93 630-715 View model · PDB
Predicted = Low TFS_sp_Q9Y467_SALL2_HUMAN:630:715_6e94_A_1 6e94 630-715 View model · PDB
Predicted = Low TFS_sp_Q9Y467_SALL2_HUMAN:692:715_1f2i_G_1 1f2i 692-715 View model · PDB
Predicted = Low TFS_sp_Q9Y467_SALL2_HUMAN:692:715_1f2i_H_1 1f2i 692-715 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
3 6e94 370:442 630 715 P:A · DNA:C,D 38.4% / 52.3% 73 View · PDB TFS_sp_Q9Y467_SALL2_HUMAN:630:715_6e94_A_1
4 6e93 370:442 630 715 P:A · DNA:C,D 38.4% / 52.3% 73 View · PDB TFS_sp_Q9Y467_SALL2_HUMAN:630:715_6e93_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
401-423PF00096Zinc finger, C2H2 typeoverlaps 372-430
659-681PF00096Zinc finger, C2H2 typeoverlaps 630-715
692-713PF00096Zinc finger, C2H2 typeoverlaps 630-715
913-936PF13912C2H2-type zinc fingerNo overlap with loaded model regions