ModCRE DB

Transcription factor

Q9Y473 - ZNF175

Zinc finger protein 175 (Zinc finger protein OTK18)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 711 aa

2 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known2
MotifPredictionSourceDNA bindingSupportLogoActions
M08292_2.00 Known CisBP TGTATTCCTTGTCATGTGTGG Direct PWM Open · Scan
MA2332.1 Known JASPAR ACAGGAAGT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 711 aa
391-666

Region 391-666 0 PWM

Residues
276 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 391-6661 model
Actions
Predicted = Low TFS_Q9Y473:391:666_5v3j_E_1 5v3j 391-666 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
26-67PF01352KRAB boxNo overlap with loaded model regions
336-357PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
363-385PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
391-413PF00096Zinc finger, C2H2 typeoverlaps 391-666
419-441PF00096Zinc finger, C2H2 typeoverlaps 391-666
447-469PF00096Zinc finger, C2H2 typeoverlaps 391-666
475-497PF00096Zinc finger, C2H2 typeoverlaps 391-666
503-525PF00096Zinc finger, C2H2 typeoverlaps 391-666
531-553PF00096Zinc finger, C2H2 typeoverlaps 391-666
559-581PF00096Zinc finger, C2H2 typeoverlaps 391-666
587-609PF00096Zinc finger, C2H2 typeoverlaps 391-666
615-637PF00096Zinc finger, C2H2 typeoverlaps 391-666
643-665PF00096Zinc finger, C2H2 typeoverlaps 391-666
671-693PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions