ModCRE DB

Transcription factor

Q9Y4A8 - NFE2L3

Nuclear factor erythroid 2-related factor 3 (NF-E2-related factor 3) (NFE2-related factor 3) (Nuclear factor, erythroid derived 2, like 3)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 694 aa

16 Generated PWM 18 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)6
MotifPredictionSourceDNA bindingSupportLogoActions
M09959_2.00 NN 70-40% CisBP ATGACTCAGCA 54.6% identity Open · Scan
M08789_2.00 NN 70-40% CisBP ATGACTCAGCAGTT 53.1% identity Open · Scan
MA0150.1 NN 70-40% JASPAR ATGACTCAGCA 53.1% identity Open · Scan
MA0150.2 NN 70-40% JASPAR CAGCATGACTCAGCA 53.1% identity Open · Scan
M01142_2.00 NN 70-40% CisBP GCATGACGA 53.0% identity Open · Scan
MA0501.1 NN 70-40% JASPAR ATGACTCAGCAATTT 52.8% identity Open · Scan
ModCRE10
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q9Y4A8_NF2L3_HUMAN:549:641_2wty_B_1 ModCRE Homology model CGTGGCAGACGCCGACTTT Region 549-641 · 1 3D model Open · Scan
DIMER_sp_Q9Y4A8_NF2L3_HUMAN:549:641_4eot_B_1 ModCRE Homology model CGGGGTCGGGGCGGAACC Region 549-641 · 1 3D model Open · Scan
DIMER_sp_Q9Y4A8_NF2L3_HUMAN:583:636_1jnm_B_1 ModCRE Homology model ATTTAATTACTAAATTAAAT Region 583-636 · 1 3D model Open · Scan
DIMER_sp_Q9Y4A8_NF2L3_HUMAN:583:637_2h7h_B_1 ModCRE Homology model TTTTTATGAGTCATAAAAA Region 583-637 · 1 3D model Open · Scan
DIMER_sp_Q9Y4A8_NF2L3_HUMAN:583:638_5t01_B_1 ModCRE Homology model TCCGGATGTTTCATTAAG Region 583-638 · 1 3D model Open · Scan
TFS_sp_Q9Y4A8_NF2L3_HUMAN:536:601_1skn_P_1 ModCRE Homology model GGGATGACATTGG Region 536-601 · 1 3D model Open · Scan
TFS_sp_Q9Y4A8_NF2L3_HUMAN:549:641_2wty_B_1 ModCRE Homology model CGGGGCCGACCCCGAATTT Region 549-641 · 1 3D model Open · Scan
TFS_sp_Q9Y4A8_NF2L3_HUMAN:583:620_1a02_J_1 ModCRE Homology model GTAAAAATTGATTAAACT Region 583-620 · 1 3D model Open · Scan
TFS_sp_Q9Y4A8_NF2L3_HUMAN:583:620_1s9k_E_1 ModCRE Homology model GTAAAATTTGTATAAAAG Region 583-620 · 1 3D model Open · Scan
TFS_sp_Q9Y4A8_NF2L3_HUMAN:583:638_1fos_F_1 ModCRE Homology model ACGGATGACCCAAAGAGG Region 583-638 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 694 aa
534-641

Region 534-641 10 PWM

Residues
108 aa
Domains
PF03131 · bZIP Maf transcription factor
3D models
18 active PDBs · 10 summary rows
Templates
1A02, 1FOS, 1JNM, 1S9K, 1SKN, 2H7H, 2WTY, 4EOT, ...
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
18 active PDB models 10 summary rows
Region 534-64118 models · 10 summary rows
Actions
Predicted = Low DIMER_sp_Q9Y4A8_NF2L3_HUMAN:534:638_7x5e_B_1 7x5e 534-638 View model · PDB
Predicted = Low DIMER_sp_Q9Y4A8_NF2L3_HUMAN:535:638_7x5f_B_1 7x5f 535-638 View model · PDB
Predicted = Low DIMER_sp_Q9Y4A8_NF2L3_HUMAN:535:638_7x5g_B_1 7x5g 535-638 View model · PDB
Predicted = Low DIMER_sp_Q9Y4A8_NF2L3_HUMAN:549:641_2wty_B_1 2wty 549-641 View model · PDB
Predicted = Low DIMER_sp_Q9Y4A8_NF2L3_HUMAN:549:641_4eot_B_1 4eot 549-641 View model · PDB
Predicted = Low DIMER_sp_Q9Y4A8_NF2L3_HUMAN:583:620_1s9k_E_1 1s9k 583-620 View model · PDB
Predicted = Low DIMER_sp_Q9Y4A8_NF2L3_HUMAN:583:636_1jnm_B_1 1jnm 583-636 View model · PDB
Predicted = Low DIMER_sp_Q9Y4A8_NF2L3_HUMAN:583:637_2h7h_B_1 2h7h 583-637 View model · PDB
Predicted = Low DIMER_sp_Q9Y4A8_NF2L3_HUMAN:583:638_5t01_B_1 5t01 583-638 View model · PDB
Predicted = Low TFS_sp_Q9Y4A8_NF2L3_HUMAN:534:638_7x5e_B_1 7x5e 534-638 View model · PDB
Predicted = Low TFS_sp_Q9Y4A8_NF2L3_HUMAN:535:638_7x5f_B_1 7x5f 535-638 View model · PDB
Predicted = Low TFS_sp_Q9Y4A8_NF2L3_HUMAN:535:638_7x5g_B_1 7x5g 535-638 View model · PDB
Predicted = Low TFS_sp_Q9Y4A8_NF2L3_HUMAN:536:601_1skn_P_1 1skn 536-601 View model · PDB
Predicted = Low TFS_sp_Q9Y4A8_NF2L3_HUMAN:549:641_2wty_B_1 2wty 549-641 View model · PDB
Predicted = Low TFS_sp_Q9Y4A8_NF2L3_HUMAN:549:641_4eot_B_1 4eot 549-641 View model · PDB
Predicted = Low TFS_sp_Q9Y4A8_NF2L3_HUMAN:583:620_1a02_J_1 1a02 583-620 View model · PDB
Predicted = Low TFS_sp_Q9Y4A8_NF2L3_HUMAN:583:620_1s9k_E_1 1s9k 583-620 View model · PDB
Predicted = Low TFS_sp_Q9Y4A8_NF2L3_HUMAN:583:638_1fos_F_1 1fos 583-638 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 7x5f 534:641 552,535 641,638 P:A,B · DNA:C,D 54.8% / 80.8% 88,99 View · PDB DIMER_sp_Q9Y4A8_NF2L3_HUMAN:535:638_7x5f_B_1
1 7x5f 534:641 552,535 641,638 P:A,B · DNA:C,D 54.8% / 80.8% 88,99 View · PDB TFS_sp_Q9Y4A8_NF2L3_HUMAN:535:638_7x5f_B_1
2 7x5e 534:641 552,534 641,638 P:A,B · DNA:C,D 54.3% / 81.0% 88,99 View · PDB DIMER_sp_Q9Y4A8_NF2L3_HUMAN:534:638_7x5e_B_1
2 7x5e 534:641 552,534 641,638 P:A,B · DNA:C,D 54.3% / 81.0% 88,99 View · PDB TFS_sp_Q9Y4A8_NF2L3_HUMAN:534:638_7x5e_B_1
3 7x5g 534:641 552,535 641,638 P:A,B · DNA:C,D 53.8% / 79.8% 88,99 View · PDB DIMER_sp_Q9Y4A8_NF2L3_HUMAN:535:638_7x5g_B_1
3 7x5g 534:641 552,535 641,638 P:A,B · DNA:C,D 53.8% / 79.8% 88,99 View · PDB TFS_sp_Q9Y4A8_NF2L3_HUMAN:535:638_7x5g_B_1
5 1s9k 534:641 584,583 629,620 P:D,E · DNA:A,B 47.4% / 68.4% 86,73 View · PDB DIMER_sp_Q9Y4A8_NF2L3_HUMAN:583:620_1s9k_E_1
4 1skn 534:641 536 601 P:P · DNA:A,B 45.5% / 60.6% 89 View · PDB TFS_sp_Q9Y4A8_NF2L3_HUMAN:536:601_1skn_P_1
4 4eot 534:641 549,549 641,641 P:A,B · DNA:C,D 32.3% / 52.7% 98,98 View · PDB DIMER_sp_Q9Y4A8_NF2L3_HUMAN:549:641_4eot_B_1
5 4eot 534:641 549,549 641,641 P:A,B · DNA:C,D 32.3% / 52.7% 98,98 View · PDB TFS_sp_Q9Y4A8_NF2L3_HUMAN:549:641_4eot_B_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
549-638PF03131bZIP Maf transcription factoroverlaps 534-641