ModCRE DB

Transcription factor

Q9Y5B6 - PAXBP1

PAX3- and PAX7-binding protein 1 (GC-rich sequence DNA-binding factor 1)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 917 aa

5 Generated PWM 5 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_4jjn_B_1 ModCRE Homology model TGAAACAGTC Region 504-528 · 1 3D model Open · Scan
TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_4kud_B_1 ModCRE Homology model CGCACCCCGCTTGGGCCCCCTGTACTTCCTAGGATTTT Region 504-528 · 1 3D model Open · Scan
TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_4kud_F_1 ModCRE Homology model CGGGGCCCCAGTGTGCACCCACGTGCACACACATGGCAC Region 504-528 · 1 3D model Open · Scan
TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_8ow0_b_1 ModCRE Homology model GGGGCC Region 504-528 · 1 3D model Open · Scan
TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_8ow0_f_1 ModCRE Homology model GTTGCCCCGTGGCCACGTGGGTGCAACACCCCCAA Region 504-528 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 917 aa
504-528

Region 504-528 5 PWM

Residues
25 aa
Domains
No overlapping PFAM annotation recorded
3D models
5 active PDBs · 5 summary rows
Templates
4JJN, 4KUD, 8OW0
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models 5 summary rows
Region 504-5285 models · 5 summary rows
Actions
Predicted = Low TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_4jjn_B_1 4jjn 504-528 View model · PDB
Predicted = Low TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_4kud_B_1 4kud 504-528 View model · PDB
Predicted = Low TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_4kud_F_1 4kud 504-528 View model · PDB
Predicted = Low TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_8ow0_b_1 8ow0 504-528 View model · PDB
Predicted = Low TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_8ow0_f_1 8ow0 504-528 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 8ow0 504:528 504 528 P:f · DNA:D,E 44.0% / 64.0% 31 View · PDB TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_8ow0_f_1
2 8ow0 504:528 504 528 P:b · DNA:D,E 44.0% / 64.0% 31 View · PDB TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_8ow0_b_1
3 4kud 504:528 504 528 P:F · DNA:I,J 44.0% / 64.0% 27 View · PDB TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_4kud_F_1
4 4jjn 504:528 504 528 P:B · DNA:I,J 44.0% / 64.0% 28 View · PDB TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_4jjn_B_1
5 4kud 504:528 504 528 P:B · DNA:I,J 44.0% / 64.0% 28 View · PDB TFS_sp_Q9Y5B6_PAXB1_HUMAN:504:528_4kud_B_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
596-807PF07842GC-rich sequence DNA-binding factor-like proteinNo overlap with loaded model regions