Transcription factor

S5M224 - TP53

Cellular tumor antigen p53

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 115 aa

6 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3

Motif	Prediction	Source	DNA binding	Support	Actions
M11197_2.00	NN 70+%	CisBP	AGACATGCCCGGGCATGTCC	99.1% identity	Open · Scan
MA0106.1	NN 70+%	JASPAR	CCGGACATGCCCGGGCATGT	99.1% identity	Open · Scan
M03440_2.00	NN 70+%	CisBP	ACATGTCATAGACATGT	90.4% identity	Open · Scan

Nearest Neighbor (70% - 40%)3

Motif	Prediction	Source	DNA binding	Support	Actions
MA0861.1	NN 70-40%	JASPAR	GACATGTCTGGACATGTC	65.5% identity	Open · Scan
M03438_2.00	NN 70-40%	CisBP	GACATGTCTGGACATGTC	64.6% identity	Open · Scan
MA0525.1	NN 70-40%	JASPAR	AGACATGCCCAGACATGCCC	62.0% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 115 aa

1-115

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 1-1151 model

				Actions
Predicted = Low	TFS_S5M224:1:115_5lgy_B_1	5lgy	1-115	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
2-114	PF00870	P53 DNA-binding domain	overlaps 1-115