ModCRE DB

Transcription factor

V9HWI2 - HEL104

Zinc finger protein 354A (Transcription factor 17)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 605 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M08914_2.00 Known CisBP ATTTAGTCCATTTACATTTAATGT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 605 aa
267-545

Region 267-545 0 PWM

Residues
279 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 267-5451 model
Actions
Predicted = Low TFS_V9HWI2:267:545_5wjq_D_1 5wjq 267-545 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
13-54PF01352KRAB boxNo overlap with loaded model regions
214-236PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
242-264PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
270-292PF00096Zinc finger, C2H2 typeoverlaps 267-545
298-320PF00096Zinc finger, C2H2 typeoverlaps 267-545
354-376PF00096Zinc finger, C2H2 typeoverlaps 267-545
382-404PF00096Zinc finger, C2H2 typeoverlaps 267-545
410-432PF00096Zinc finger, C2H2 typeoverlaps 267-545
438-460PF00096Zinc finger, C2H2 typeoverlaps 267-545
466-488PF00096Zinc finger, C2H2 typeoverlaps 267-545
494-516PF00096Zinc finger, C2H2 typeoverlaps 267-545
522-544PF00096Zinc finger, C2H2 typeoverlaps 267-545
550-572PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
578-600PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions