ModCRE DB

Transcription factor

V9TLK5 - AR

Androgen receptor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 262 aa

9 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
MA0007.2 NN 70+% JASPAR AAGAACAGAATGTTC 99.6% identity Open · Scan
MA0007.1 NN 70+% JASPAR ATAAGAACACCCTGTACCCGCC 99.2% identity Open · Scan
MA0007.3 NN 70+% JASPAR GGGAACACGGTGTACCC 99.2% identity Open · Scan
Nearest Neighbor (70% - 40%)6
MotifPredictionSourceDNA bindingSupportLogoActions
M03923_2.00 NN 70-40% CisBP AGAACACTGTGTACC 66.6% identity Open · Scan
M07987_2.00 NN 70-40% CisBP GCCCAGAACATTCTGTTCCCT 54.3% identity Open · Scan
M03382_2.00 NN 70-40% CisBP GGGAACACAATGTTCCC 52.8% identity Open · Scan
MA0727.1 NN 70-40% JASPAR GGGAACACAATGTTCCC 52.8% identity Open · Scan
MA0113.1 NN 70-40% JASPAR GGGAACATTATGTCCTAA 50.6% identity Open · Scan
M05886_2.00 NN 70-40% CisBP AGTACATTTTGTTCT 50.2% identity Open · Scan
ModCRE0

No generated PWM in this category.

AF3 model assignments
Validated exact-accession AF3 models stored in local staging. Confidence artifacts are indexed but not visualized yet.
1 active AF3 model
TypeModelResidues / fragmentInterfaceConfidence filesActions
AF3 full-length model V9TLK5_model.cif Full sequence PASS_NONEMPTY_PROTEIN_DNA_INTERFACE 3 indexed View model · mmCIF

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomain
41-219PF00104Ligand-binding domain of nuclear hormone receptor