ModCRE DB

Transcription factor

X6R674 - IVNS1ABP

Influenza virus NS1A binding protein

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 135 aa

1 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08864_2.00 NN 70-40% CisBP CCTCCCCCCCCGCCCCCTCCCC 51.1% identity Open · Scan
ModCRE0

No generated PWM in this category.

No DNA-interacting structure identified

None of the 6 assessable structural models contains a protein–DNA non-hydrogen atom contact within 4.5 Å.

3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
SourceModelTemplateResidues modeledActions
Predicted = Lowx6r674.af3.0-Full sequenceView model · PDB
Predicted = Lowx6r674.af3.1-Full sequenceView model · PDB
Predicted = Lowx6r674.af3.2-Full sequenceView model · PDB
Predicted = Lowx6r674.af3.3-Full sequenceView model · PDB
Predicted = Lowx6r674.af3.4-Full sequenceView model · PDB
Predicted = Lowx6r674.af3.5-Full sequenceView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomain
22-128PF00651BTB/POZ domain